Logo Понеделник, 19 Ноември
Конституция Правилници
Кодекси Правилници по прилагане
Наредби Последен брой на ДВ
Закони


НАРЕДБА № 24 ОТ 14 ДЕКЕМВРИ 2005 Г. ЗА МЕРКИТЕ ЗА ПРОФИЛАКТИКА, ОГРАНИЧАВАНЕ И ЛИКВИДИРАНЕ НА АФРИКАНСКАТА ЧУМА ПО КОНЕТЕ И ЗА УСЛОВИЯТА И РЕДА ЗА ПРИЛАГАНЕТО ИМ

В сила от 01.05.2006 г.
Издадена от министъра на земеделието и горите

Обн. ДВ. бр.6 от 20 Януари 2006г., изм. ДВ. бр.79 от 29 Септември 2006г., изм. ДВ. бр.102 от 19 Декември 2006г., изм. ДВ. бр.4 от 15 Януари 2010г., изм. ДВ. бр.86 от 18 Октомври 2018г.

Раздел I.
Общи положения


Чл. 1. С тази наредба се определят:
1. мерките за профилактика, ограничаване и ликвидиране на африканската чума по конете (АЧК);
2. задълженията на ветеринарномедицинските органи, на физическите и юридическите лица при прилагането на мерките по т. 1 и методите по т. 3;
3. методите за диагностика на АЧК;
4. условията и редът за прилагане на мерките по т. 1.





Чл. 2. Африканската чума по конете се обявява по ред, определен с наредбата на министъра на земеделието и горите по чл. 50, ал. 3 от Закона за ветеринарномедицинската дейност (ЗВД).


Чл. 3. (1) (Изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Българската агенция по безопасност на храните (БАБХ) изготвя план за действие (контингенс план) за прилагане на мерките и методите по чл. 1, т. 1 и 3 (приложение № 1), който се утвърждава от изпълнителния директор на БАБХ.
(2) Планът по ал. 1 се представя на Европейската комисия (ЕК) за одобрение най-късно 3 месеца след влизане в сила на наредбата.
(3) (Изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Българската агенция по безопасност на храните изменя плана по ал. 1 по предложение на ЕК за привеждането му в съответствие с плановете на другите държави-членки.
(4) (Изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Българската агенция по безопасност на храните може да изменя плана по ал. 1 при промени в епизоотичната обстановка само след разрешение от ЕК.
(5) (Нова - ДВ, бр. 79 от 2006 г., в сила от 01.01.2007 г.) За постигане на пълна координация при прилагане на необходимите мерки за ерадикация на АЧК по възможно най-бързия начин и за извършване на епизоотологичното проучване се създава кризисен център. Основните правила, касаещи националния кризисен център, се приемат и одобряват от съвета по предложение на ЕК.

Раздел II.
Мерки за профилактика на африканската чума по конете


Чл. 4. (Изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Българската агенция по безопасност на храните:
1. извършва идентификация на еднокопитните животни и регистрация на обектите, в които те се отглеждат;
2. контролира придвижването, пазарите, изложбите и спортните състезания с еднокопитни животни;
3. извършва наблюдение и проучване на видовия състав на векторите от вида "куликоиде" и други вектори и вирусологично изследване на проби от тях;
4. извършва дезинфекция и дезинсекция на влизащите в страната транспортни средства, които превозват еднокопитни животни.


Чл. 5. (1) (Изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) При възникване на АЧК в съседни държави освен мерките по чл. 4 БАБХ извършва в граничните райони и:
1. ежеседмични клинични прегледи на еднокопитните животни;
2. сондажни серологични изследвания.
(2) (Изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Когато огнището на АЧК е на по-малко от 150 км от границата с Република България, БАБХ предприема мерките по раздел III след съгласуване с ветеринарната служба на засегнатата държава.

Раздел III.
Мерки при съмнение за възникване на африканска чума по конете


Чл. 6. (1) (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г., изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) При съмнение за АЧК ветеринарният лекар, който обслужва животновъдния обект, незабавно уведомява областната дирекция по безопасност на храните (ОДБХ), която изпраща на място официален ветеринарен лекар за извършване на проучване за потвърждаване или налагане на необходимите мерки.
(2) (Отм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.)


Чл. 7. (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) След получаване на уведомлението по чл. 6 официалният ветеринарен лекар посещава обекта, в който е възникнало съмнението за АЧК, и:
1. поставя животновъдния обект под възбрана;
2. изготвя и актуализира при всяко посещение в обекта списък, който съдържа броя на наличните, родените, съмнително болните, заболелите и умрелите еднокопитни животни;
3. извършва проучване на:
а) биотопите и определя средства за дезинсекция;
б) наличието на вектори в обекта и провежда дезинсекция за тяхното унищожаване, съгласно приложение № 2;
4. извършва епизоотологично проучване по реда на чл. 12, ал. 1, т. 5;
5. извършва клиничен преглед на еднокопитните животни в засегнатия обект;
6. извършва аутопсия на умрелите еднокопитни животни и взема материал за лабораторно изследване;
7. разпорежда прибирането на еднокопитните животни в затворено помещение или на място, където животните могат да бъдат предпазени от вектори;
8. забранява вкарване, изкарване и преместване на еднокопитни животни, постеля, фураж, тор, инвентар, транспортни средства и други предмети, които могат да бъдат вектори;
9. предприема мерки за унищожаване векторите на болестта чрез прилагане на подходящи средства във и около помещенията, в които са настанени еднокопитни;
10. дава указания за обезвреждане на умрелите животни при условия и по ред, определени с Наредба № 20 от 2006 г. за изискванията към дейностите, извършвани на всички етапи от събирането до обезвреждането на странични животински продукти и на продукти, получени от тях, както и тяхната употреба, пускане на пазара и транзитно преминаване (ДВ, бр. 18 от 2006 г.);
11. (изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) уведомява кмета и собствениците на еднокопитни животни в населеното място за опасността от възникване на АЧК и предприетите от БАБХ мерки;
12. забранява на работещите в обекта да посещават други животновъдни обекти, в които се отглеждат еднокопитни.


Чл. 8. (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г., изм. - ДВ, бр. 102 от 2006 г., в сила от 19.12.2006 г.) До въвеждане на мерките по чл. 7 собственикът на еднокопитните животни в обекта, в който е възникнало съмнение за АЧК, предприема мерките по чл. 7, т. 7 - 10.


Чл. 9. (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) Когато при проучването по чл. 12, ал. 1, т. 5 възникне съмнение за заразяване с АЧК на еднокопитни животни и в други животновъдни обекти предвид тяхното местоположение, географско разположение или контакт с обекти, в които има съмнение за наличие на болестта, официалният ветеринарен лекар предприема мерките по чл. 7.


Чл. 10. Официалният ветеринарен лекар отменя мерките по чл. 7, когато епизоотологичните, клиничните и патологоанатомичните данни и резултатите от лабораторните изследвания не потвърдят съмнението за АЧК.


Чл. 11. (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) Ваксинацията срещу АЧК може да се прилага само в съответствие с изискванията на наредбата.

Раздел IV.
Мерки за ограничаване и ликвидиране на африканската чума по конете


Чл. 12. (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) (1) Когато наличието на АЧК е лабораторно потвърдено, официалният ветеринарен лекар:
1. незабавно започва умъртвяване в заразения обект на всички еднокопитни животни, показващи клинични признаци на АЧК и показалите положителен резултат при АЧК;
2. трябва да създаде условия за унищожаване, изгаряне или загробване на труповете на еднокопитните животни по т. 1 в съответствие с изискванията, посочени в Наредба № 20 от 2006 г. за изискванията към дейностите, извършвани на всички етапи от събирането до обезвреждането на странични животински продукти и на продукти, получени от тях, както и тяхната употреба, пускане на пазара и транзитно преминаване (ДВ, бр. 18 от 2006 г.) и Наредба № 22 от 2006 г. за условията и реда за обезвреждане на странични животински продукти и на продукти, получени от тях, и на специфичнорискови материали извън обектите, регистрирани в РВМС (ДВ, бр. 21 от 2006 г.);
3. налага мерките, посочени в чл. 7 - 10, върху всички обекти, разположени в радиус 20 km (включени в "предпазната зона") около заразения/те обект/и;
4. започва систематична ваксинация на всички еднокопитни в зоната, посочена в т. 3, с ваксина, одобрена от компетентния орган, като тези животни се маркират с ясна, незаличима маркировка, приложена по метод, одобрен в Европейския съюз; на базата на епизоотологичните, метеорологичните, географските и климатичните данни компетентният орган може да отмени изискването за ваксинация, като за това уведоми Европейската комисия (ЕК);
5. извършва епизоотологично проучване, което включва изясняване на:
а) предполагаемата дата на възникване на АЧК и начина на проникване на инфекцията в засегнатия обект;
б) източника на инфекцията в засегнатия обект и възможността за заразяване на еднокопитни животни в други обекти с вируса на АЧК от същия източник;
в) наличието и разпространението на вектори;
г) броя на еднокопитните животни, постъпили или напуснали засегнатия обект, и на труповете на еднокопитни животни, напуснали обекта.
(2) Когато възникне съмнение за широко разпространение на АЧК, компетентният орган налага мерките, предвидени в ал. 1, извън зоната, посочена в ал. 1, т. 3, след анализ на географските, екологичните и метеорологичните условия или движенията до и от обекта/ите, където болестта е била потвърдена.
(3) За мерките по ал. 2 компетентният орган уведомява ЕК.
(4) Когато територията на заразената зона включва част от територия на повече от една държава, компетентните органи на държавите определят границите на зоната и мерките, които ще се предприемат в нея. Тази зона се определя според процедурата в Европейския съюз.


Чл. 13. (1) (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г., изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Българската агенция по безопасност на храните определя предпазна зона и наблюдавана зона в зависимост от епизоотологичните данни, географските, административните и екологичните особености, свързани с АЧК и създадените структури за контрол.
(2) (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) Предпазната зона обхваща територията в радиус най-малко 100 км около засегнатия обект.
(3) (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) Наблюдаваната зона обхваща територията в радиус най-малко 50 км от външната граница на предпазната зона, в която не е била извършвана ваксинация срещу АЧК през последните 12 месеца.
(4) (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г., изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Когато територията на предпазна зона или наблюдавана зона обхваща територията на повече от една държава, БАБХ и ветеринарните служби на тези държави определят границите на зоната и мерките, които ще се предприемат в нея.


Чл. 14. (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г., изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Българската агенция по безопасност на храните след съгласуване с Постоянния комитет по хранителната верига и здравеопазването на животните към ЕК може да разшири границите на заразена зона, предпазна зона или наблюдавана зона в зависимост от:
1. тяхното географско разположение и екологични фактори;
2. метеорологичните условия;
3. наличието и разпространението на вектори;
4. (изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) резултатите от извършеното епизоотологично проучване по чл. 12, ал. 1, т. 5;
5. резултатите от лабораторните изследвания;
6. (изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) ефикасността на извършваните мерки за контрол и в частност мерките за унищожаване на насекомите.


Чл. 15. (1) (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) В предпазната зона официалният ветеринарен лекар:
1. изготвя списък на животновъдните обекти, в които се отглеждат еднокопитни животни, и броя на животните в тях;
2. извършва:
а) периодични посещения на всички животновъдни обекти, в които има еднокопитни животни;
б) клинични прегледи на животните в обектите по буква "а";
в) (изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) сондажни серологични изследвания за АЧК по схема, утвърдена от изпълнителния директор на БАБХ;
г) проверка на документацията на животновъдните обекти по буква "а", свързана с посещенията на обслужващия ветеринарен лекар и резултатите от тях;
3. (изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) разрешава транспортирането на еднокопитни животни от обектите, в които се отглеждат, само когато животните са предназначени за незабавно клане в намираща се в зоната кланица, посочена от БАБХ, а когато в зоната няма такава кланица - разрешава транспортирането на животните до намираща се в надзорната зона кланица, посочена от БАБХ.
(2) (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г., изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Освен мерките по ал. 1 изпълнителният директор на БАБХ може да внесе предложение съгласно процедурата на Европейския съюз за извършване на систематична ваксинация на еднокопитните животни срещу АЧК в предпазната зона, като тези животни се идентифицират. Решението за ваксинация се издава със заповед на министъра на земеделието и горите, която включва:
1. територията, на която ще се провежда ваксинацията;
2. еднокопитните животни, които ще се ваксинират;
3. схемата на ваксинация;
4. начина на идентификация на ваксинираните животни.
(3) (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) Мерките в предпазна зона се отменят 60 дни след умъртвяване на всички болни или серопозитивни за АЧК животни в заразената зона след извършена дезинсекция в засегнатите обекти и получени отрицателни резултати от лабораторните изследвания.


Чл. 16. (1) (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) В наблюдавана зона официалният ветеринарен лекар предприема мерките по чл. 15, ал. 1.
(2) (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г., изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Когато в наблюдавана зона няма подходяща кланица, еднокопитните животни от тази зона могат да бъдат заклани в намираща се в предпазна зона кланица, посочена от БАБХ.
(3) (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) Забранява се ваксинацията срещу АЧК в наблюдавана зона.
(4) (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) Мерките в наблюдавана зона се отменят при условията на чл. 15, ал. 3.


Чл. 17. (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) (1) При ваксинация срещу АЧК мерките в заразената, предпазната и надзорната зона се изпълняват най-малко 12 месеца след извършване на ваксинацията.
(2) Независимо от мерките по чл. 15, ал. 1 и чл. 16, ал. 1 и 2 официалният ветеринарен лекар може да разреши транспортиране на еднокопитни животни до карантинните депа на територията на предпазната и надзорна зона съгласно изискванията по чл. 6 и 7 от Наредба № 45 от 2006 г. за здравните изисквания при придвижване на еднокопитни животни между Република България и държавите - членки на Европейския съюз, и внасянето от трети страни (ДВ, бр. 43 от 2006 г).
(3) Придвижването на еднокопитни животни в зони с един и същи статут се разрешава от компетентния орган, когато:
1. на животните е извършен клиничен преглед;
2. животните са идентифицирани;
3. на животните им е извършено серологично изследване за АЧК и резултатът от него е отрицателен;
4. животните са придружени от ветеринарномедицински сертификат.
(4) Ваксинираните срещу АЧК животни не могат да излизат от обектите, в които се отглеждат, най-малко 60 дни след извършване на ваксинацията.
(5) (Изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Българската агенция по безопасност на храните информира ЕК за мерките по ал. 1.


Чл. 18. (Изм. - ДВ, бр. 102 от 2006 г., в сила от 19.12.2006 г., изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) При особено сериозна епизоотия от африканска чума по конете в отделен регион БАБХ след съгласуване с Постоянния комитет по хранителната верига и здравеопазването на животните към ЕК изменя мерките за ограничаване и ликвидиране на АЧК.


Чл. 19. (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г., изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Българската агенция по безопасност на храните своевременно информира лицата, които участват в прилагане на мерките за ограничаване и ликвидиране на АЧК в предпазна зона и наблюдавана зона, за въведените ограничения, които тези лица трябва да изпълнят.

Раздел V.
Диагностика на африканската чума по конете


Чл. 20. (Изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Българската агенция по безопасност на храните оказва съдействие на експерти от ЕК при извършване на проверки относно прилагането на мерките по тази наредба.


Чл. 21. (Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) (1) (Доп. - ДВ, бр. 4 от 2010 г., в сила от 15.01.2010 г., изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Лабораторните изследвания за поставяне на диагнозата АЧК се извършват в националната референтна лаборатория за африканска чума по конете съгласно приложение № 3. Списък с координатите на тази лаборатория, както и всички последващи промени се публикуват на интернет страницата на БАБХ.
(2) (Изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Централното управление (ЦУ) на БАБХ осъществява постоянен контрол за спазване на изискванията за безопасност при работа с вируса на АЧК в лабораторията по ал. 1.
(3) Лабораторията по ал. 1 си сътрудничи с референтната лаборатория на Европейския съюз по приложение № 4.


Чл. 22. (1) (Изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) При съмнение за АЧК директорът на съответната ОДБХ незабавно информира изпълнителния директор на БАБХ.
(2) (Изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) В случаите по ал. 1 изпълнителният директор на БАБХ незабавно изпраща на място специализиран диагностичен екип от ЦУ на БАБХ и НДНИВМИ.
(3) Екипът по ал. 2 извършва клиничен преглед, аутопсия на умрелите животни и взема материали за лабораторно изследване за изолиране на вируса, както следва:
1. кръвни проби, взети по време на температурния стадий на болестта, които се съхраняват в разтвор, съдържащ 50% глицерин, 0,5% калиев оксалат и 0,5% фенол или хепарин 10 UI/мл;
2. парченца от далак, бял дроб, лимфни възли с тегло от 2 до 4 г, поставени в 10 % буфериран глицерин;
3. вектори - 10 сборни проби с най-малко 300 насекоми във всяка от тях;
4. кръвни серуми от болни и съмнително болни животни.
(4) Материалите за лабораторно изследване се транспортират в хладилна чанта при температура 4°С.


Чл. 23. (1) Лабораторните изследвания се извършват чрез:
1. изолиране на вируса:
а) върху чувствителни клетъчни култури;
б) чрез интравенозна инокулация на 10 - 11-дневни кокоши ембриони;
в) чрез интрацеребрална инокулация на новородени бозаещи мишлета;
2. идентификация на вируса чрез:
а) реакция ензим свързан имуносорбентен метод (ЕЛАЙЗА) - с хомогенати от миши мозък, органи и клетъчно културална течност;
б) реакция вируснеутрализация за определяне на серотипа на вируса;
в) полимеразно верижна реакция;
3. серологична диагностика с помощта на:
а) реакция сравнителна ЕЛАЙЗА за доказване на антитела срещу вируса на АЧК;
б) реакция индиректна ЕЛАЙЗА за доказване на антитела срещу вируса на АЧК;
в) реакция блокираща ЕЛАЙЗА за доказване на антитела срещу вируса на АЧК;
г) реакция за свързване на комплемента;
д) реакция имуноблотинг.
(2) Лабораторните изследвания по ал. 1 се извършват съгласно приложение № 3.


Чл. 24. Ръководителят на лабораторията по чл. 20, ал. 1:
1. поддържа постоянна диагностична готовност;
2. незабавно разпорежда да се изследват получените проби;
3. (изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) уведомява за резултата от изследването на пробите по т. 2 ЦУ на БАБХ и съответната ОДБХ;
4. използва утвърдените от Световната организация по здравеопазване на животните методи за диагностика;
5. контролира качеството на всички реактиви, използвани при извършване на отделните изследвания;
6. организира провеждането на сравнителни тестове;
7. съхранява изолатите на вируса на АЧК от потвърдени случаи в страната;
8. изпраща проби за потвърждаване на диагнозата АЧК в Референтната лаборатория на Европейския съюз.


Чл. 25. Диагноза АЧК се поставя въз основа на епизоотологичните, клиничните и патологоанатомичните данни, както и от резултатите от лабораторните изследвания по чл. 22, ал. 1.

Допълнителни разпоредби


§ 1. По смисъла на тази наредба:
1. "Еднокопитни животни" са домашни и диви животни от рода "Еквиде".
2. "Африканска чума по конете" е заразно вирусно заболяване по еднокопитните животни, причинявано от орбивирус от семейство "Реовириде", което се характеризира с повишена телесна температура (40° - 41°С), спазматична кашлица, изтечения от ноздрите, зачервяване на конюнктивата, белодробен едем и висока смъртност. Предава се чрез ухапване от кръвосмучещи насекоми от вида "Куликоидес".
3. "Куликоиди" са дребни кръвосмучещи насекоми от род "Куликоиде", семейство "Кератопогониде".
4. "Биотоп" е територия, където протича развитието на ларвите на куликоидите.
5. "Серопозитивно животно" е животно, което е изследвано серологично за АЧК и резултатът от изследването е положителен.
6. (изм. - ДВ, бр. 102 от 2006 г., в сила от 19.12.2006 г., изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) "Официален ветеринарен лекар" е ветеринарен лекар, назначен по служебно правоотношение и определен със заповед на изпълнителния директор на БАБХ.
7. "Реакция имуноблотинг" е реакция, извършвана върху хартиен носител за доказване на причинителя на инфекцията.
8. "Преимагинални стадии" са стадии преди появата на определени признаци.
9. "Полимеразно верижна реакция" е реакция, използваща доказване на причинителя на инфекцията чрез нуклеиновата киселина.
10. "Цитопатичен ефект" е поражение на клетки след действие на специфичен вирус.
11. "Конюгат" е белязан с ензим или химично вещество белтък.
12. "Супернатант" е течност, намираща се над утайката, получена след центрофугиране.
13. "Пероксидаза" е специфичен ензим, получаван от хрян.
14. "Ридър" е електронно четящо устройство за реакция Ензим свързан имуносорбентен метод.
15. "Преципитация" е срещане на две вещества в агаров гел.
16. "Амплификация" е намножаване на даден участък от веригата на нуклеиновата киселина.
17. "Секвенции" е изолиране на определени части.
18. "Праймер" е фрагмент, необходим за доказване на определена част от нуклеиновата киселина.
19. "Компететивен" е взаимно конкурентен.
20. "Титриране" е определяне на активност чрез последователни разреждания.
21. "Хромоген" е химично вещество, използвано за доказателство при ензимна реакция.
22. "Ортофенилендиаминов разтвор" е химично вещество, необходимо за доказване на наличието на ензим.
23. "Инхибиция" е потискане действието на дадено вещество.
24. "Скрининг тест" е серологично изследване на голям брой животни.
25. "Вирулентен вирус" е вирус, изолиран от терена по време на активно заболяване.
26. "Комплемент" е биологично вещество, изолирано от кръвта на морско свинче, необходимо за извършване на определена лабораторна реакция.
27. "Хемолизин" е биологично вещество, изолирано от кръвта на заек, необходимо за извършване на определена лабораторна реакция.
28. "Вектор" е насекомо от вида "Imicola Culicoides" или друг куликоид, който може да предава вируса на АЧК.
29. (нова - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) "Собственик" е физическо или юридическо лице, което притежава животните или е отговорно за тяхното отглеждане срещу заплащане или безплатно.
30. (нова - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г., изм. - ДВ, бр. 102 от 2006 г., в сила от 19.12.2006 г.) "Потвърждение" е доказване наличието на болестта африканска чума по конете на определена територия на базата на лабораторни изследвания, а при епизоотия - на базата на клинични и/или епизоотологични данни.
31. (нова - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г., изм. - ДВ, бр. 102 от 2006 г., в сила от 19.12.2006 г., изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) "БАБХ" е специализиран орган за управление, осъществяване и контрол на ветеринарномедицинската дейност.


§ 1а. (Нов - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г., доп. - ДВ, бр. 4 от 2010 г., в сила от 15.01.2010 г.) Тази наредба въвежда Директива на Съвета 92/35 и изискванията на чл. 14 от Директива 2008/73/ЕО на Съвета от 15 юли 2008 г. за опростяване на процедурите по вписване и публикуване на информация във ветеринарната и зоотехническата област и за изменение на директиви 64/432/ЕИО, 77/504/ЕИО, 88/407/ЕИО, 88/661/ЕИО, 89/361/ЕИО, 89/556/ЕИО, 90/426/ЕИО, 90/427/ЕИО, 90/428/ЕИО, 90/429/ЕИО, 90/539/ЕИО, 91/68/ЕИО, 91/496/ЕИО, 92/35/ЕИО, 92/65/ЕИО, 92/66/ЕИО, 92/119/ЕИО, 94/28/EO, 2000/75/EO, Решение 2000/258/ЕО и директиви 2001/89/EO, 2002/60/ЕО и 2005/94/EO, обнародвана в ОВ, бр. L 219 от 2008 г.

Заключителни разпоредби


§ 2. Тази наредба се издава на основание чл. 47, ал. 3 от Закона за ветеринарномедицинската дейност и отменя Наредба № 43 от 2002 г. за профилактика и борба с болестта африканска чума по конете (ДВ, бр. 98 от 2002 г.).


§ 3. Наредбата влиза в сила от 01.V.2006 г.

Заключителни разпоредби
КЪМ НАРЕДБА ЗА ИЗМЕНЕНИЕ И ДОПЪЛНЕНИЕ НА НАРЕДБА № 24 ОТ 2005 Г. ЗА МЕРКИТЕ ЗА ПРОФИЛАКТИКА, ОГРАНИЧАВАНЕ И ЛИКВИДИРАНЕ НА АФРИКАНСКАТА ЧУМА ПО КОНЕТЕ И ЗА УСЛОВИЯТА И РЕДА ЗА ПРИЛАГАНЕТО ИМ


(ОБН. - ДВ, БР. 79 ОТ 2006 Г., В СИЛА ОТ 29.09.2006 г.)

§ 18. Навсякъде в наредбата думите "Зона "А" се заменят със "заразена зона", "Зона "Б" с "предпазна зона", "Зона "В" с "наблюдавана зона" и "Собственик или гледач" със "Собственик".

§ 19. Наредбата влиза в сила от деня на обнародването и в "Държавен вестник", с изключение на § 1, който влиза в сила от 1.I.2007 г.

Преходни и Заключителни разпоредби
КЪМ НАРЕДБА ЗА ИЗМЕНЕНИЕ НА НАРЕДБА № 24 ОТ 2005 Г. ЗА МЕРКИТЕ ЗА ПРОФИЛАКТИКА, ОГРАНИЧАВАНЕ И ЛИКВИДИРАНЕ НА АФРИКАНСКАТА ЧУМА ПО КОНЕТЕ И ЗА УСЛОВИЯТА И РЕДА ЗА ПРИЛАГАНЕТО ИМ


(ОБН. - ДВ, БР. 102 ОТ 2006 Г., В СИЛА ОТ 19.12.2006 Г.)

§ 4. Наредбата влиза в сила от деня на обнародването и в "Държавен вестник".

Заключителни разпоредби
КЪМ НАРЕДБА ЗА ДОПЪЛНЕНИЕ НА НАРЕДБА № 24 ОТ 2005 Г. ЗА МЕРКИТЕ ЗА ПРОФИЛАКТИКА, ОГРАНИЧАВАНЕ И ЛИКВИДИРАНЕ НА АФРИКАНСКАТА ЧУМА ПО КОНЕТЕ И ЗА УСЛОВИЯТА И РЕДА ЗА ПРИЛАГАНЕТО ИМ


(ОБН. - ДВ, БР. 4 ОТ 2010 Г., В СИЛА ОТ 15.01.2010 Г.)

§ 3. Наредбата влиза в сила от деня на обнародването и в "Държавен вестник".

Преходни и Заключителни разпоредби
КЪМ НАРЕДБА ЗА ИЗМЕНЕНИЕ И ДОПЪЛНЕНИЕ НА НАРЕДБА № 102 ОТ 2006 Г. ЗА МЕРКИТЕ ЗА ПРОФИЛАКТИКА, ОГРАНИЧАВАНЕ И ЛИКВИДИРАНЕ НА БОЛЕСТТА АФРИКАНСКА ЧУМА ПО СВИНЕТЕ И ЗА УСЛОВИЯТА И РЕДА ЗА ПРИЛАГАНЕТО ИМ


(ОБН. - ДВ, БР. 86 ОТ 2018 Г., В СИЛА ОТ 18.10.2018 Г.)

§ 3. В Наредба № 24 от 2005 г. за мерките за профилактика, ограничаване и ликвидиране на африканската чума по конете и за условията и реда за прилагането им (обн., ДВ, бр. 6 от 2006 г.; изм., бр. 79 и 102 от 2006 г., бр. 4 от 2010 г.) се правят следните изменения:
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2. Навсякъде в наредбата думите "Националната ветеринарномедицинска служба", "генералният директор" и "генералния директор" се заменят съответно с "Българската агенция по безопасност на храните", "изпълнителният директор" и "изпълнителния директор", а абревиатурите "НВМС" и "РВМС" се заменят съответно с "БАБХ" и "ОДБХ".
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

§ 5. Наредбата влиза в сила от деня на обнародването и в "Държавен вестник".

Приложение № 1 към чл. 3

(Изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г., изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.)

Съдържание на плана за действие (контингенс плана) при съмнение или възникване на АЧК

1. (изм. - ДВ, бр. 86 от 2018 г., в сила от 18.10.2018 г.) Заповед на изпълнителния директор на БАБХ за създаване на Национален координационен център за контрол на мерките за ограничаване и ликвидиране на АЧК.
2. Заповед на директора на ОДБХ за създаване на регионален координационен център за контрол на мерките по т. 1.
3. Списък на ветеринарномедицинските специалисти, изпълняващи мерките по т. 1., като са посочени квалификацията и задълженията им.
4. Информация за възможностите на всеки регионален координационен център за незабавно организиране на неговите членове при поява на огнище на АЧК.
5. Списък на моторните превозни средства (регистрационни номера и шофьори), дезинфекционна, дезинсекционна и друга техника, препарати за дезинфекция и дезинсекция, инструменти и оборудване, необходими за провеждане на мерките по т. 1.
6. Инструкции, които посочват последователността на действията при предприемане на мерките по т. 1, включително за начините на обезвреждане на труповете.
7. Програми за обучение на ветеринарномедицинските специалисти, свързани с прилагане на мерките по т. 1.
8. (изм. - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.) Изисквания към оторизираната лаборатория за диагностика на АЧК.
9. Разчет на необходимото количество ваксини срещу АЧК при необходимост от принудителна ваксинация.


Приложение № 2 към чл. 7, т. 3, буква "б"

(Предишно Приложение № 2 към чл. 12, ал. 2, т. 2, буква "б" - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.)

Правила за дезинсекция при африканска чума по конете

При извършване на дезинсекцията се цели унищожаване на векторите. Тя включва следните мерки:
1. Мерки срещу преимагиналните стадии на развитие на векторите:
а) премахване на биотопите за развитие на ларвите на векторите чрез отводняване на водоемите със застояла вода (блата, мочурища, канавки, вирове и др.);
б) обработване на биотопите, неподдаващи се на мелиорация, с одобрени ларвицидни средства на всеки 10 - 14 дни от април до октомври.
2. Мерки за унищожаване на възрастните вектори:
а) унищожаване на куликоидите в откритото пространство в радиус 5 - 10 км от епизоотичното огнище чрез опръскване с авиотехника по метода "ултранисък обем" или чрез използване на топъл или студен аерозол и димни шашки - извършва се привечер, нощем или рано сутрин през 10 - 14 дни;
б) унищожаване на влетелите в помещенията вектори чрез опръскване, димни шашки или обгазяване с топъл или студен аерозол при отсъствието на животните.
3. Мерки за предотвратяване влитането на вектори в помещенията:
а) замрежване на прозорците със ситна мрежа (сечение 1 мм2) и поставяне на допълнителни летящи входни врати от същата мрежа;
б) обработка на помещенията отвън с инсектицидни препарати през 10 дни.
4. Мерки за предпазване от ухапване на еднокопитните животни от вектори чрез третиране на животните с подходящи инсектицидни препарати.


Приложение № 3 към чл. 21, ал. 1

(Ново - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.)

НАЦИОНАЛНА РЕФЕРЕНТНА ЛАБОРАТОРИЯ ЗА АФРИКАНСКА ЧУМА ПО КОНЕТЕ
БЪЛГАРИЯ

Национална референтна лаборатория за африканска чума по конете
бул. Пенчо Славейков 15, ПК 1606, София, България.


Приложение № 4 към чл. 21, ал. 3

(Ново - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.)

РЕФЕРЕНТНА ЛАБОРАТОРИЯ НА ОБЩНОСТТА ЗА АФРИКАНСКА ЧУМА ПО КОНЕТЕ
Laboratorio de sanidad y produccion animal, Ministerio de Agricultura, Pesca y Alimentacion, 28110 Algete, Madrid
ИСПАНИЯ.


Приложение № 5 към чл. 23, ал. 2

(Предишно Приложение № 3 към чл. 22, ал. 2 - ДВ, бр. 79 от 2006 г., в сила от 29.09.2006 г.)

Диагностика на болестта африканска чума по конете

Реактивите за извършване на описаните методи могат да бъдат получени от референтните лаборатории за АЧК от Европейската общност или референтните лаборатории на Световната организация за здравеопазване на животните.
Идентификация на вируса
За идентификацията на вируса на африканската чума по конете се използват следните лабораторни техники и методи - ЕЛАЙЗА за бързо доказване на вируса, използвайки поликлонални (ПКА) и моноклонални (МКА) антитела, полимеразно верижна реакция (PCR) и инокулиране на клетъчни култури и новородени мишлета. Винаги трябва да се правят всички тестове при съмнение за АЧК, като се започне от бързите ЕЛАЙЗА или PCR. Изолирането на вирус върху клетъчни култури и последвалото извършване на вирусно неутрализационна реакция (ВНР) с оглед серотипизирането на щама е необходимо да бъде направено от самото начало на появата на болестта. Най-често в лабораториите се прилага реакция ЕЛАЙЗА за поставяне на бърза диагноза. От изключителна важност при поставянето на диагноза АЧК е правилното вземане и транспортиране на пробите до лабораторията.
Проби за изолиране на вируса
Стабилизирана кръв с антикоагулант, взета по време на температурния стадий на болестта от болните животни, малки парченца (2 - 4 г) от далак, бял дроб и лимфни възли от умрели животни. Пробите се съхраняват и транспортират при 4°С.

1. Клетъчни култури
За изолиране на вируса на АЧК успешно се използват постоянна клетъчна линия от бъбрек на хамстер (BHK 21) и постоянна клетъчна линия от миши бъбрек (VERO). Кръвните проби с хепарин се използват за инокулиране неразредени, като след 60 мин адсорбция клетките се промиват и се добавя поддържаща среда. При заразяването на клетъчните линии с органни суспензии от далак, бял дроб и лимфен възел те трябва да бъдат 10%-ни (обем/обем), приготвени с фосфатен буфер (PBS) или клетъчно културална среда, съдържаща антибиотици. При наличие на вирус се появява цитопатичен ефект на клетъчни култури (ЦПЕ) от два до осем дни след заразяването. Задължително се извършват три слепи пасажа преди поставянето на отрицателна диагноза.

2. Новородени мишлета
За изолиране на вируса се използва и интрацеребрално заразяване на 1 - 3-дневни новородени мишлета най-малко от две семейства. При положителна реакция при животните се установяват нервни признаци между 3-тия и 15-ия ден след инокулацията. Мозъкът от всичките мишлета (по семейства) се събира, хомогенизира и инокулира повторно на нови най-малко шест новородени мишлета. При този втори пасаж нервните признаци трябва да се появят по-рано (от 2-рия до 5-ия ден) при 100% заразяемост.

3. Сандвич ЕЛАЙЗА
Най-малко две реакции ЕЛАЙЗА са разработени за доказване на вирусен антиген от теренни проби или лабораторно заразени клетъчни култури. Едната техника използва поликлонални антитела (ПКА), а другата - моноклонални (МКА), на един и същ основен протеин, който е общ за повечето серотипове на заболяването - VP7. Двата метода могат да се прилагат независимо един от друг, като чрез тях бързо (от 2 до 4 часа) се поставя диагноза АЧК. Реагентите за тези реакции се получават в случай на нужда от Референтната лаборатория за АЧК в Европейския съюз.
3.1. Извършване на ЕЛАЙЗА теста при използването на моноклонално антитяло
3.1.1. Твърда фаза - плаките се натоварват със смес от МКА 5G5 и 3D2, разтворени в PBS съответно 10 µl/ml всяко с последвала инкубация една нощ на 4°С.
3.1.2. След трикратно промиване на плаките с дестилирана вода, съдържаща 0,05% Tween 20, те внимателно се изтръскват върху адсорбиращ материал до отстраняване на излишната течност в ямките.
3.1.3. Накапва се по 200 µl на ямка блокиращ разтвор, съдържащ PBS + 1% говежди серумен албумин (БСА), за един час на 37°С.
3.1.4. Изсипва се внимателно блокиращият разтвор и се изтръскват плаките.
3.1.5. Пробите за изследване (далачни суспензии или клетъчнокултурална течност) се накапват в неразредено състояние, последвано от две разреждания в PBS + 1% БСА по 100 µl на ямка, с последвала инкубация от 1 час на 37°С. Суспензията от органи (далак, бял дроб, л. възел) се получава, като 2 см (около 1 г) от органа се хомогенизират в 3 мл MEM (Minimal essential medium) среда, с последвало центрофугиране на 600 g за 10 мин, като се използва супернатантът.
3.1.6. Плаките се промиват трикратно.
3.1.7. Във всяка ямка се накапва конюгат - по 100 µl биотин-макрирано 5G5 МКА, в разреждане 1:500 в PBS + 1% БСА. След инкубиране за един час на 37 °С плаките се промиват и се накапва по 100 µl на ямка авидин-пероксидаза в оптимално разреждане в PBS + 1% БСА, с последвал престой 45 мин на стайна температура.
3.1.8. Плаките се промиват трикратно и в тях се накапва по 200 µl на ямка субстратен разтвор 10 мл 80,6 mM DMAB (dimethyl aminobenzaldehyde) + 10 мл fj 1,56 mM MBTH (3-methyl-2-benzo-thiazolinone hydrazone) + 5 µl H2O2. Цветната реакция се спира чрез прибавяне на 50 µl разтвор на 3N H2SO4 за около 5 - 10 мин, преди отрицателната контрола да започне да се оцветява.
3.1.9. Плаките се отчитат на ридър при 600 или 620 nm.
3.2. Интерпретиране на резултатите
3.2.1. Първо се изчислява пределната стойност, както следва - С + 0,06 (където С е стойността на отрицателната контрола, 0,6 е стандартното отклонение, получено при група от 30 отрицателни серума).
3.2.2. Пробите, показали стойност, по-ниска от тази, се смятат за отрицателни.
3.2.3. При по-големи стойности от пределната стойност + 0,15 се считат за положителни.
3.2.4. Пробите, показали лъжливо положителни резултати, се подлагат отново на изследване за потвърждаване на резултатите.

4. Полимеразно верижна реакция
PCR тестът е специфичен за доказване на вирусния РНК на АЧК. Праймерите кореспондират с 5' края (нуклеотиди 1 - 21) и в 3' края (нуклеотиди 1160 - 1179) от сегмент 8 от РНК на вируса.
Извършване на теста
От далачна суспензия се екстрахира нуклеиновата киселина, както следва: 1 г от пробата се хомогенизира в 1 мл от денатуриращ разтвор (4 М guanidium thiocyanate, 25 mM sodium citrate, 0,1 M 2-mercaptoethanol, 0,5 % sarcosyl), след което се извършва центрофугиране. Към супернатанта се прибавят 1 g чиста РНК, 0,1 ml of 2 M sodium acetate pH4, 1 ml phenol and 0,2 ml chloroform/isoamyl alcohol mixture (49/1), като получената смес внимателно се разбърква в продължение на 15 мин в баня от лед. Следва отделяне на преципитираната РНК на вируса след фенолна екстракция и преципитация с алкохол. Методът на ДНК синтезата и PCR амплификацията се прилага при 37°C. Секвенциите на PCR праймерите използват последователност 5' GTTAAAATTCGGTTAGGATG 3', която винаги кореспондира с поляритета на добавената РНК. Анализът на получения резултат чрез PCR се извършва посредством електрофореза с 1,2% агаразен гел, съдържащ ethidium bromide.

5. Серологични тестове
Индиректният вариант на ЕЛАЙЗА, използващ разтворим вирус на АЧК или рекомбиниран VP7 протеин за доказване на антитела, се прилага доста често. Имуноблотинг тестът също е адаптиран за доказване на антитела срещу вируса на АЧК. Напоследък приложение намери и ЕЛАЙЗА, използваща неструктурния протеин NS3 за антиген, като тази реакция може да служи при разграничаването на ваксинирани от инфектирани животни. РСК се прилага повсеместно, но при някои серуми не се наблюдава антикомплементарна активност.
5.1. Сравнителна ЕЛАЙЗА за доказване на антитела срещу вируса на африканската чума по конете
Сравнителната ЕЛАЙЗА се използва за доказване на антитела срещу вируса на АЧК в серуми от различни видове и категории еднокопитни. Принципът на реакцията се състои в компететивно свързване на антитела срещу вируса на АЧК. Така реакцията, която протича между антигена и антителата от антиморскосвински серум, се променя при добавяне на серумна проба с наличие на антитела срещу вируса, което визуално се отразява в промяна на оцветяването след прибавяне на ензим. Изследваните серуми могат да бъдат тестирани при единично разреждане 1:5 или да бъдат титрирани за установяване на крайното разреждане. Стойности, по-високи от 50%, могат да се считат за положителни. Този метод се използва в регионалната референтна лаборатория за АЧК в Пърбрайт, Великобритания.
Извършване на теста
5.1.1. Подготовка на плаките
5.1.1.1. Плаките за ЕЛАЙЗА се натоварват с 100 µl на ямка антиген на вируса АЧК, екстрахиран от клетъчно културална течност и разреден в карбонатно-бикарбонатен буфер с рН 9,6, за една нощ при 4°С.
5.1.1.2. Плаките се промиват трикратно с PBS с рН 7,2 - 7,4, след което се подсушават.
5.1.2. Контролни ямки на плаките
5.1.2.1. Положителните контролни серуми се титрират в двойна серия разреждане, започващи от 1:5 до 1:640, в колона 1 в блокиращ буфер (PBS + 5% обезмаслено сухо мляко Cadbury's Marvel TM + 0,05% w/v Tween 20 и 1% ГСА) до получаване на 50 µl на ямка.
5.1.2.2. Към ямки А и В от колона 2 се добавя 50 µl от отрицателния серум при разреждане 1:5 (10 µl серум + 40 µl блокиращ буфер).
5.1.2.3. В ямки С и D от колона 2 (празна) се добавя 100 µl на ямка блокиращ буфер.
5.1.2.4. В ямки E, F, G и H от колона 2 се накапва 50 µl блокиращ буфер.
5.1.3. Метод за единична титрация:
Прибавя се в разреждане 1:5 серум в блокиращ буфер в колоните от 3 до 12 (10 µl серуми + 40 µl блокиращ буфер).
Или:
5.1.4. Метод на титрацията:
Приготвят се двойни серийни разреждания от 1:5 до 1:640 в блокиращ буфер в осем ямки от единични колони (3 до 12).
След което:
5.1.5. Добавят се 50 µl антисерум от морско свинче, предварително разреден в блокиращ буфер във всички ямки на плаката с изключение на празните (така навсякъде количеството е 100 µl на ямка).
5.1.5.1. Плаките се инкубират за 1 час при 37°С върху орбитален шейкър.
5.1.5.2. Плаките се промиват трикратно, след което се подсушават.
5.1.5.3. Към всяка ямка се прибавя 50 µl конюгат: заешки антиморскосвински пероксидаза, предварително разтворен в блокиращ буфер.
5.1.5.4. Инкубира се в продължение на 1 час при 37°С върху орбитален шейкър.
5.1.5.5. Плаките се промиват трикратно и се подсушават.
5.1.6. Хромоген
Ортофенилендиаминовият разтвор се приготвя според инструкциите (0,4 мг/мл в стерилна дестилирана вода) непосредствено преди употреба. Добавя се субстрат водороден прекис до крайна концентрация 0,05% v/v (1 към 2000 на 30% разтвор на Н2О2). Във всяка ямка се накапва по 50 µl от Орто фенилен диамин разтвора, като след 10-минутен престой на стайна температура реакцията се спира чрез прибавяне на ямка 50 µl 1М H2SO4.
5.1.7. Отчитане
Извършва се на ЕЛАЙЗА ридър при дължина на вълната 492 nm.
5.1.8. Интерпретиране на резултатите
5.1.8.1. С помощта на софтуерна програма се отчитат резултатите от оптичната плътност. За валидиране на теста е необходимо горната граница и долната контролна граница на серума от морско свинче да са между 1,4 и 0,4. Крайният титър за положителния контролен серум, базиран на 50%, трябва да бъде 1:240 в граници от 1:120 до 1:480. Всяка плака, която не отговаря на стандарта, трябва да се изхвърли. Въпреки това, ако при отрицателните серуми титърът е 1:480 и нагоре, те могат да се приемат за отрицателни. Двойните серумни ямки на отрицателната контрола и празните трябва да дават стойности съответно между +25% и -25% и между +95% и +105%. При положение че стойностите са извън тези граници, това не означава, че плаката е невалидна, а е признак за оцветяване.
5.1.8.2. Проби, даващи инхибиция повече от 50%, се считат за положителни. Проби, при отчитането на които стойностите са под 50%, се считат за отрицателни. При двойните проби, при които се установяват стойности от различните кладенчета под и над 50%, се считат за съмнителни. Обикновено тези проби се подлагат на повторно изследване. Положителните проби също могат да се титрират с цел да се установи степента на положителност.


Метод за единична титрация
 
  1 2 3 4 5 6 7 8 9 10 11 12
  +контр.           Тест серуми        
A 1:5 -                    
    контр.                    
B 1:10 -                    
    контр.                    
C 1:20 Празен                    
D 1:40 Празен                    
E 1:80 MC                    
    кон.                    
F 1:160 MC                    
    кон.                    
G 1:320 MC                    
    кон.                    
H 1:640 MC                    
    кон.                    
- контр. = отрицателна контрола
+ контр. = положителна контрола
MC контр. = контрола "морскосвински" серум
Метод на титрация
 
  1 2 3 4 5 6 7 8 9 10 11 12
  +контр.           Тест серуми        
A 1:5 - 1:5                 1:5
    контр.                    
B 1:10 - 1:10                 1:10
    контр.                    
C 1:20 Празен 1:20                 1:20
D 1:40 Празен 1:40                 1:40
E 1:80 MC 1:80                 1:80
    кон.                    
F 1:160 MC 1:160                 1:160
    кон.                    
G 1:320 MC 1:320                 1:320
    кон.                    
H 1:640 MC 1:640                 1:640
    кон.                    
- контр. = отрицателна контрола
+ контр. = положителна контрола
MC контр. = контрола "морскосвински" серум

5.2. Индиректна ЕЛАЙЗА за доказване на антитела
Тестът използва VP7 протеина като антиген за установяване на антитела срещу вируса на АЧК
5.2.1. Процедура на теста:
5.2.1.1. Твърда фаза
5.2.1.1.1. Плаките се натоварват с рекомбиниран АЧКВ 4 VP7, разреден в карбонатно-бикарбонатен буфер с рН 9,6, след което се инкубират една нощ на 4°С.
5.2.1.1.2. Плаките се промиват петкратно с дестилирана вода, съдържаща 0,01 % Tween20.
5.2.1.1.3. Накапва се по 200 µl на ямка блокиращ разтвор, съдържащ PBS + 5% обезмаслено сухо мляко "Нестле", с престой 1 час на 37°С.
5.2.1.1.4. Внимателно се излива блокиращият разтвор и плаките се подсушават.
5.2.1.2. Серумни проби:
5.2.1.2.1. Серумите заедно с положителния и отрицателния серум се разреждат 1:25 в разтвор, съдържащ PBS + 5% обезмаслено сухо мляко "Нестле" + 0,05% Tween 20, и се накапват в количество по 100 µl на ямка с последвала инкубация от 1 час на 37°С. При титрирането се прави двойна серия разреждания в цяла колонка, като същото важи и за положителния и отрицателния серум.
5.2.1.2.2. Плаките се промиват, както е описано в т. 2.
5.2.1.3. Конюгат
5.2.1.3.1. Антиконски глобулин, маркиран с пероксидаза, разреден в разтвор, съдържащ PBS + 5% обезмаслено сухо мляко "Нестле" + 0,05% Tween 20 с рН 7,21, се поставя по 100 µl във всяка ямка, с последвала инкубация 1 час на 37°С.
5.2.1.3.2. Плаките се промиват, както е описано в т. 2.
5.2.1.4. Хромоген/субстрат
Във всяка ямка се поставя по 200 µl на ямка субстратен разтвор (10 мл 80,6 mM DMAB (dimethyl aminobenzaldehyde) + 10 мл fj 1,56 mM MBTH (3-methyl-2-benzo-thiazolinone hydrazone) + 5 µl H2O2). Цветната реакция се спира чрез прибавяне на 50 µl разтвор на 3N H2SO4 за около 5 - 10 мин, преди отрицателната контрола да започне да се оцветява.
5.2.1.5. Плаките се отчитат на ридър при дължина на вълната 600 или 620 nm.
5.2.2. Интерпретиране на резултатите
5.2.2.1. Първо се изчислява cut-off стойността, както следва - С + 0,06 (където С е стойността на отрицателната контрола, 0,6 е стандартното отклонение, получено при група от 30 отрицателни серума).
5.2.2.2. Пробите, показали стойност, по-ниска от тази, се смятат за отрицателни.
5.2.2.3. При по-големи стойности от cut-off + 0,15 се считат за положителни.
5.2.2.4. Пробите, показали лъжливо положителни резултати, се подлагат отново на изследване за потвърждаване на резултатите.
5.3. Блокираща ЕЛАЙЗА за доказване на антитела срещу вируса на АЧК
Чрез метода се доказват специфични антитела срещу вируса на АЧК в серуми от възприемчиви към болестта животни. Основен антиген на реакцията е VP7 протеинът, който е основен за всичките девет серотипа. Този метод се извършва в референтната лаборатория по АЧК на Европейската общност в Алхете, Испания.
5.3.1. ЕЛАЙЗА тест
5.3.1.1. ЕЛАЙЗА плаки
5.3.1.1.1. Плаките се натоварват с новополучен АЧКВ VP7, разреден в карбонатно-бикарбонатен буфер с рН 9,6, с последвала инкубация за една нощ при 4 °С.
5.3.1.1.2. Плаките се промиват петкратно с PBS, съдържащ 0,05% v/vTween 20 (PBST).
5.3.1.1.3. Плаката се стабилизира със стабилизиращ разтвор, което позволява тя да престоява продължително време на 4°С.
5.3.1.2. Контроли със серумни проби
5.3.1.2.1. Скрининг тест серумите и контролите се разреждат в PBST1:10 директно върху плаката до получаване на краен обем 100 µl на ямка, с последвала инкубация от 1 час при 37°С.
5.3.1.2.2. Титрация: приготвя се двойна серия разреждане на тестираните серуми и положителните контроли (100 µl на ямка от 1:10 до 1:280). Отрицателните контроли се разреждат 1:10.
5.3.1.3. Конюгат
Добавя се по 50 µl на ямка предварително разреден моноклонално антитяло срещу VP7, маркирано с пероксидаза, като след хомогенизиране и разбъркване престоява 30 мин при 37°С.
5.3.1.4. Плаките се промиват петкратно с PBST и се подсушават.
5.3.1.5. Хромоген/субстрат
Прибавят се по 100 µl на ямка хромоген/субстратен разтвор (1 мл ABTS(2,2'-Azino-bis-[3-етилбензотиазолин-6-sulphuric acid]) 5 mg/ml + 9 ml субстратен разтвор (0,1 M фосфатно-цитратен буфер с рН 4, съдържащ 0,03% H2O2) и се инкубира в продължение на 10 мин на стайна температура. Оцветяването се спира чрез прибавяне на 100 µl на ямка 2% (w/v) SDS (sodium dodecyl sulphate).
5.3.1.6. Отчитане
Извършва се посредством ЕЛАЙЗА ридър при дължина на вълната 405 nm.
5.3.2. Интерпретиране на резултатите.
5.3.2.1. Валидност на теста
Той е валиден, когато оптичната плътност на отрицателната контрола (ОК) е по-висока от 1,0, а тази на положителната контрола (ПК) е по-ниска от 0,2.
5.3.2.2. Изчисляване на пределните стойности:
положителна стойност (ПК) - ОК - (ОК - ПК) x 0,3;
отрицателна стойност (ОК) - ОК - (ОК - ПК) x 0,2,
където ОК е екстинцията на отр. контрола, а ПК - на положителната.
5.3.2.3. Интерпретиране на резултатите
Проби с екстинция, по-ниска от положителната стойност, се считат за положителни за антитела срещу АЧКВ.
Проби с екстинция, по-висока от отрицателната стойност, се считат за отрицателни за антитела срещу АЧКВ.
Проби с екстинция между тези две стойности се считат за съмнителни, като две до три седмици след това се вземат нови кръвни проби от същите животни и се подлагат отново на изследване с теста.
5.4. Имуноблотинг тест
Свързването на антитела с вирусни протеини, разделени при електрофореза и след това прехвърлени върху нитроцелулозна мембрана, също се прилага като метод за доказване на антитела срещу вируса на АЧК.
5.4.1. Тест процедура
Полупречистените протеини от вируса на АЧК се разделят с помощта на SDS-PAGE (sodium dodecyl sulphate-polyacrylamide gel electrophoresis) в 15% acrylamide-N,N'-diallytartar-diamide (DATD) гел. Така разделените протеини се прехвърлят върху нитроцелулозни мембранни филтри при постоянен ток със сила 280 mA за 6 часа при 4°С. Нитроцелулозните мембрани се изрязват и се обработват с тестираните серуми в разреждане 1:20, след това с конюгат, маркиран с пероксидаза заешки антиконски имуноглобулин - 1:500, и се инкубира за 1 час на 37°С. Оцветяването на бендовете се извършва посредством 4-хлор-нафтол техника.
5.4.2. Интерпретиране на резултатите
Сравняват се бендовете на положителната и отрицателната контрола с тези на изследваните серуми. Появата на повече от два бенда показва, че серумът е положителен за наличие на антитела срещу вируса на АЧК.
5.5. ЕЛАЙЗА срещу неструктурните протеини на вируса (NS3 ЕЛАЙЗА)
Тази реакция се използва, за да може да се различават антитела,получени вследствие на ваксинация с AHSV-4, и такива, които са инфектирани с вирулентен вирус.
5.6. Реакция за свързване на комплемента (РСК)
РСК се използва с оглед установяването на групово специфични антикомплементални антитела срещу вируса на АЧК. Най-често като антиген се използва захарно-ацетонов екстракт от миши мозък. При отсъствие на стандартизин серум антигенът се титрира срещу местен положителен серум. За контролен антиген служи миши мозък, получен по същия начин от здрави мишки.
Серумите от коне трябва да бъдат инактивирани на 56°С, серумите от зебри на 60°С, а от магарета на 62°С за 30 мин. Тестираните серуми се разреждат 1:10 и се инактивират по посочения начин. Титрацията на положителните контроли се извършва в двукратни разреждания. Антигените - положителен и контролен, се разреждат в буфер, съдържащ 4 - 8 антигенни единици във veronal buffered saline, съдържащ 1% gelatin (VBSG);
морскосвинският комплемент се разрежда във VBSG до 4 CH50 (50% complement haemolytic units). Серумите, комплементът и антигенът се свързват, поставени в 96-ямкови плаки с равно дъно или в епруветки, поставени на 4°C за 18 часа. Хемолизинът се разрежда в реакцията до 2 хемолитични единици и се употребява заедно с промити овчи еритроцити. Еритроцитите се стандартизират до 3% концентрация и се добавят в ямките. Реакцията продължава с инкубация за 30 мин на 37°C. Плаките се центрофугират на 200 g и се отчита наличието на хемолиза. За контроли служат: (а) серум и комплемент (b) серум и еритроцити (c) антиген и контролен, всеки с 4 CH50, 2 CH50, and 1 CH50 от комплемента (d) антиген с еритроцити (e) контролен антиген с еритроцити (f) разреждания на комплемента от 4 CH50, 2 CH50, and 1 CH5 и (g) еритроцити. Титърът се определя от най-високото разреждане на серум, фиксирано от комплемента с положителния антиген. Така титър в разреждане от 1/10 се счита за положителен, а под 1/10 - за отрицателен.
5.7. Реакция вирус неутрализация (ВНР)
ВНР се използва се определяне на серотипа.
Вирусният антиген се разрежда до 30 - 100 TCID50 (50% tissue cultureinfective dose) за 25 µl и 25 µl се прибавя във всяка епруветка, съдържаща 25 µl серумни разреждания. При скринингови изследвания се използва разреждане на серума до 1:10.
Сместа от серум с вирус се инкубира за 60 минути при 37°C преди добавяне на 0,1 ml от VERO клетъчна суспензия (200 000 клетки/ml) във всяка епруветка.
При титрация вирусният антиген се приготвя за тестване на четири разреждания по 25 µl на ямка. Плаките се инкубират на 37°C, 5% CO2, 95% влажност за 4 - 5 дни, при съдържание на вирус 30 - 100 TCID50.
Плаките се фиксират и оцветяват с разтвор на 0,15% crystal violet in2% glutaraldehyde, след което се промиват.
За 50% крайна точка на титъра на серума се изчислява по метода на Spearman-Karber и се определя отрицателният log10.


  |   ↑ нагоре   |   ← назад   |   пълна версия

© Lex.bg     Контакти